SEQÜENCIAMENTO DO GENOMA HUMANO



Estratégias para o seqüenciamento do genoma humano:

  • Estratégia Clone-by-clone (consórcio publico):
    Generação de marcadores nos cromossomos humanos:
    • RHM (radiation hybrid mapping).
    • RFLP (restriction fragment length polymorphisms).
    • VNTR (variable number tandem repeats)/minisatélites.
      Altamente polimórficas, aparecem geralmente nas extremidades dos cromossomos.
    • STS (sequence tagged sites)/PCR-based. Sensível, mas não é útil em análise de ligação genética.
    • Microsatélites/STS, polimórficos, repeticões de 2-4 pb.
    • ESTs (expressed sequence tags).
  • Estratégia de Shotgun (Celera).


Mapeamento Com Marcadores Moleculares


A estratégia de mapeamento é feita usando grandes insertos em bactérias ou leveduras. Os Clones são selecionados usando marcadores de DNA conhecidos no cromossomo.


Os Clones são organizados por seu conteúdo de DNA e os "gaps" são preenchidos por "walking"


Mapeamento do Gene:


MET-ATCCCGATCCG-D7S8


Caminhando e saltando no DNA:


Baseado em software de predição e identificação de seqüências associadas a start/stop códons as regiões codificantes são localizados

As similaridades de seqüências são procuradas em Bancos de Dados

Os membros de uma família de gene são procurados em Bancos de Dados

Ferramentas de anotação e fluxo de dados


Finalização da seqüência:
Seqüência de cDNA seqüência de aminoácidos função da proteína


...TCCAAAGATATAGCAATTTT
GGATGACCTTCTGCCTCTTAC
CATATTTGACTTCATCCAGTT
GTTATTAATTGTGATTGGAGC
TATAGCA...

...rLysAspIleAlaIleLeuAspAspLeu
LeuProLeuThrIlePheAspPheIleGln
LeuLeuLeuIleValIleGlyAlaIleAla...


Gene Proteína Função

Giselda MK Cabello, MSc.
Responsável pelo Projeto Fibrose Cística
Laboratório de Genética Humana
Departamento de Genética/IOC/FIOCRUZ
gkalil@ioc.fiocruz.br